Review




Structured Review

Addgene inc sgrna1
Sgrna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/usp19+sgrna1/USP19+sgRNA1+(Plasmid+%2378585)/pm40112045-193-4-20
Average 93 stars, based on 19 article reviews
sgrna1 - by Bioz Stars, 2026-08
93/100 stars

Images



Similar Products

93
Addgene inc sgrna1
Sgrna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/usp19+sgrna1/USP19+sgRNA1+(Plasmid+%2378585)/pm40112045-193-4-20
Average 93 stars, based on 1 article reviews
sgrna1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc paper n a ggttcttcgccgctgttccct sgrna1 gggtgtgttgaagccggcgtc
Paper N A Ggttcttcgccgctgttccct Sgrna1 Gggtgtgttgaagccggcgtc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/usp19+sgrna1/USP19+sgRNA1+(Plasmid+%2378585)/10__1016_slash_j__isci__2025__112267-335-6-33
Average 93 stars, based on 1 article reviews
paper n a ggttcttcgccgctgttccct sgrna1 gggtgtgttgaagccggcgtc - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc usp19 sgrna1
Usp19 Sgrna1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/usp19+sgrna1/USP19+sgRNA2+(Plasmid+%2378586)/pm39948244-63-1-17
Average 93 stars, based on 1 article reviews
usp19 sgrna1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Addgene inc sgrna2 tacgtccgagacacagtcgt sirt7 sgrna1 cgttaccaggtccgcgctct
(A) Western blot using a pan-lactyllysine antibody to analyze Kla levels on acid-extracted histones from wild type (“WT”), Sirt6 knockout (“S6KO”), and <t>Sirt7</t> knockout (“S7KO”) U2OS cells in the presence of a titration of sodium L-lactate. Total protein was measured using a fluorescent total protein stain. (B) As in panel A but using a pan-acetyllysine antibody to analyze levels of histone Kac. (C) Western blots from panel A quantified by normalizing Kla signal to total protein then represented as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test. p (slope, S6KO v. WT) < 0.0001. p (slope, S7KO v. WT) = 0.39. (D) Western blots from panel B quantified by normalizing Kac signal to total protein then represented as a fold-change from the untreated condition. For WT and S6KO, n=3. For S7KO, n=2. Error plotted as S.D. (E) Baseline histone lactylation in untreated cells was measured using a pan-Kla antibody as in panel A and normalized to the loading control. The blot images used to generate this plot are shown in . Error plotted as S.D., p = 0.68.
Sgrna2 Tacgtccgagacacagtcgt Sirt7 Sgrna1 Cgttaccaggtccgcgctct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/usp19+sgrna1/USP19+sgRNA2+(Plasmid+%2378586)/bio_rxiv__2024__09__28__615627-122-47-70
Average 93 stars, based on 1 article reviews
sgrna2 tacgtccgagacacagtcgt sirt7 sgrna1 cgttaccaggtccgcgctct - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

Image Search Results


(A) Western blot using a pan-lactyllysine antibody to analyze Kla levels on acid-extracted histones from wild type (“WT”), Sirt6 knockout (“S6KO”), and Sirt7 knockout (“S7KO”) U2OS cells in the presence of a titration of sodium L-lactate. Total protein was measured using a fluorescent total protein stain. (B) As in panel A but using a pan-acetyllysine antibody to analyze levels of histone Kac. (C) Western blots from panel A quantified by normalizing Kla signal to total protein then represented as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test. p (slope, S6KO v. WT) < 0.0001. p (slope, S7KO v. WT) = 0.39. (D) Western blots from panel B quantified by normalizing Kac signal to total protein then represented as a fold-change from the untreated condition. For WT and S6KO, n=3. For S7KO, n=2. Error plotted as S.D. (E) Baseline histone lactylation in untreated cells was measured using a pan-Kla antibody as in panel A and normalized to the loading control. The blot images used to generate this plot are shown in . Error plotted as S.D., p = 0.68.

Journal: bioRxiv

Article Title: Sirtuin 6 is a histone delactylase

doi: 10.1101/2024.09.28.615627

Figure Lengend Snippet: (A) Western blot using a pan-lactyllysine antibody to analyze Kla levels on acid-extracted histones from wild type (“WT”), Sirt6 knockout (“S6KO”), and Sirt7 knockout (“S7KO”) U2OS cells in the presence of a titration of sodium L-lactate. Total protein was measured using a fluorescent total protein stain. (B) As in panel A but using a pan-acetyllysine antibody to analyze levels of histone Kac. (C) Western blots from panel A quantified by normalizing Kla signal to total protein then represented as a fold-change from the untreated condition. n=3, error plotted as S.D. Slopes of linear regressions were compared using Welch’s t-test. p (slope, S6KO v. WT) < 0.0001. p (slope, S7KO v. WT) = 0.39. (D) Western blots from panel B quantified by normalizing Kac signal to total protein then represented as a fold-change from the untreated condition. For WT and S6KO, n=3. For S7KO, n=2. Error plotted as S.D. (E) Baseline histone lactylation in untreated cells was measured using a pan-Kla antibody as in panel A and normalized to the loading control. The blot images used to generate this plot are shown in . Error plotted as S.D., p = 0.68.

Article Snippet: For mammalian cell overexpression, the full length, human Sirt6 sequence with a C-terminal FLAG tag was cloned into a pLJM1 mammalian expression vector with a CMV promoter (“pLJM1-Sirt6-3xFLAG”)., For the human cell knockouts, the following sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector: Sirt6: sgRNA1-CCTGAAGTCGGGGATGCCAG, sgRNA2-TACGTCCGAGACACAGTCGT Sirt7: sgRNA1-CGTTACCAGGTCCGCGCTCT, sgRNA2-GCTTCAGGCCCTCGCGCCGC, sgRNA3-GGCCCTGCAGCTCCGTTACC The oligonucleotide design and cloning were performed according to the protocol provided by the Zhang lab on the Addgene #62988 website.

Techniques: Western Blot, Knock-Out, Titration, Staining, Control